Journal: FEBS letters

Article Title: Hypoxia-induced endothelial-mesenchymal transition is associated with RASAL1 promoter hypermethylation in human coronary endothelial cells.

doi: 10.1002/1873-3468.12158

Figure Lengend Snippet: Fig. 3. Silencing of DNMT3a expression alleviates hypoxia-induced EndMT. (A–D) qRT-PCR results showing the mRNA expression of DNA methyltransferases (DNMT1, DNMT3a, DNMT3b and DNMT3l) in normoxic and hypoxic cells. DNMT3a is significantly upregulated upon hypoxia treatment. (E) qRT-PCR results showing DNMT3a mRNA expression in the cells which were transfected with different DNMT3a siRNA oligos. The combination of all three oligos contributed to over 70% reduction in DNMT3a. (F) Western blot results showing increased DNMT3a protein expression under hypoxic condition but not under normoxic condition, both transfected with combined DNMT3a. DNMT3a siRNAs treatment under hypoxic condition abolished expression of DNMT3a. (G) qRT-PCR results showing DNMT1, DNMT3b, and DNMT3l mRNA expression in HCAEC cells transfected with DNMT3a siRNA compared to cells transfected with scrambled control. (H) Western blot analysis showing protein expression of CD31, S100A4, a-SMA in DNMT3a siRNA transfected cells compared to scrambled control transfected cells. All blots were reprobed with an anti-a-TUBULIN antibody as a control for equal loading. (I) qRT-PCR results showing DNMT3a mRNA expression in cells transfected with scrambled controls siRNA treated with normoxia and hypoxia and cells transfected with combined DNMT3a siRNAs treated with hypoxia. (J) DNA virtual gel pictures showing the MeDIP results of decreased methylation level of immunoprecipitated RASAL1 promoter in DNMT3a siRNA transfected cells compared to scrambled control transfected cells under hypoxic condition. (K) qRT-PCR data showing mRNA expression of the key EndMT transcription factors (SNAIL, SLUG, and TWIST) in DNMT3a siRNA transfected cells as compared to scrambled control transfected cells exposed to hypoxic condition (gene expression and associated error bars, representing mean SEM, n = 3 independent experiments, n.s., no significance, *P < 0.05, **P < 0.01, ***P < 0.001).

Article Snippet: For gene silencing experiment, DNMT3a siRNAs were purchased from OriGene (Rockville, MD, USA). pLKO.1 vector was used for generating of pLKO.1shSMAD2 (CCAGCAGGAATTGAGCCACAGAGTAAT TA), pLKO.1-shSMAD4 (CCAACATTCCTGTGGCTTCCACAAGTCAG) constructs.

Techniques: Expressing, Quantitative RT-PCR, Transfection, Western Blot, Control, Methylated DNA Immunoprecipitation, Methylation, Immunoprecipitation, Gene Expression

Journal: FEBS letters

Article Title: Hypoxia-induced endothelial-mesenchymal transition is associated with RASAL1 promoter hypermethylation in human coronary endothelial cells.

doi: 10.1002/1873-3468.12158

Figure Lengend Snippet: Fig. 6. Hypoxia induces EndMT in HCAEC cells through different pathways. Schematic representation of hypoxia-induced endothelial- to-mesenchymal transition through different cascades. Under hypoxic condition, transcription factor HIF1a protein is stabilised, which can directly activate EndMT transcriptional factor, Snail, to trigger the EndMT program. Besides, hypoxia can also activate TGFb2 receptor regulated signalling pathway through SMAD2/3 proteins to induce EndMT transcription factor expression. In addition, we identified that hypoxia synergistically induces EndMT by DNMT3a-mediated hypermethylation of RASAL1 with consecutive Ras hyperactivity.

Article Snippet: For gene silencing experiment, DNMT3a siRNAs were purchased from OriGene (Rockville, MD, USA). pLKO.1 vector was used for generating of pLKO.1shSMAD2 (CCAGCAGGAATTGAGCCACAGAGTAAT TA), pLKO.1-shSMAD4 (CCAACATTCCTGTGGCTTCCACAAGTCAG) constructs.

Techniques: Expressing

Journal: Molecular Cancer

Article Title: Benzo[ a ]pyrene diol epoxide suppresses retinoic acid receptor-β 2 expression by recruiting DNA (cytosine-5-)-methyltransferase 3A

doi: 10.1186/1476-4598-9-93

Figure Lengend Snippet: ChIP assay . Esophageal cancer TE-3 cells were grown and treated with 1 μM BPDE for up to 24 h. After that, the cells were fixed with formaldehyde for 10 min, and the nuclei were then isolated, sonicated, and immunoprecipitated with anti-BPDE antibodies. (A) Immunoprecipitated protein was subjected to Western blotting analysis of DNMT3A and DNMT3B expression. Protein without anti-BPDE antibody immunoprecipitation (input) was used as the control. PC, positive control. (B) Immunoprecipitated DNA was subjected to PCR analysis of RAR-β 2 gene promoter.

Article Snippet: DNMT3A shRNAs were purchased from OriGene Technologies (Rockville, MD).

Techniques: Isolation, Sonication, Immunoprecipitation, Western Blot, Expressing, Control, Positive Control

Journal: Molecular Cancer

Article Title: Benzo[ a ]pyrene diol epoxide suppresses retinoic acid receptor-β 2 expression by recruiting DNA (cytosine-5-)-methyltransferase 3A

doi: 10.1186/1476-4598-9-93

Figure Lengend Snippet: Effect of BPDE on DNMT3A and DNMT3B expression . TE-3 cells were grown and treated with 1 μM BPDE for up to 24 h. After that, total cellular protein was extracted and subjected to Western blotting analysis of DNMT3A and DNMT3B expression.

Article Snippet: DNMT3A shRNAs were purchased from OriGene Technologies (Rockville, MD).

Techniques: Expressing, Western Blot

Journal: Molecular Cancer

Article Title: Benzo[ a ]pyrene diol epoxide suppresses retinoic acid receptor-β 2 expression by recruiting DNA (cytosine-5-)-methyltransferase 3A

doi: 10.1186/1476-4598-9-93

Figure Lengend Snippet: Reversal of BPDE's effect on RAR-β 2 expression using 5-Aza . (A) ChIP assay. Esophageal cancer TE-3 cells were grown and treated with or without 1 μM BPDE, 10 μM 5-Aza, or the combination of both for 12 h, and the cells were then subjected to ChIP analysis with anti-BPDE antibodies. The immunoprecipitated protein was subjected to Western blotting analysis of DNMT3A expression. Proteins without anti-BPDE antibody immunoprecipitation (input) were used as controls. (B) Northern blotting. Total RNA from TE-3 and TE-12 cells with the same treatment was isolated and subjected to Northern blotting analysis of RAR-β 2 expression.

Article Snippet: DNMT3A shRNAs were purchased from OriGene Technologies (Rockville, MD).

Techniques: Expressing, Immunoprecipitation, Western Blot, Northern Blot, Isolation

Journal: Molecular Cancer

Article Title: Benzo[ a ]pyrene diol epoxide suppresses retinoic acid receptor-β 2 expression by recruiting DNA (cytosine-5-)-methyltransferase 3A

doi: 10.1186/1476-4598-9-93

Figure Lengend Snippet: Effects of DNMT3A shRNA . (A) Knockdown of DNMT3A expression by DNMT3A shRNA. Esophageal cancer TE-3 cells were grown and transiently transfected with DNMT3A 29 mer shRNA constructs in pRS vector; 48 h later, total cellular protein was extracted and then subjected to Western blotting analysis of DNMT3A expression. (B) RT-PCR analysis of RAR-β 2 mRNA expression. Esophageal cancer TE-3 cells were grown and transiently transfected with DNMT3A shRNA-3 vector; 48 h later, the cells were treated with or without 1 μM BPDE for 12 h and RNA was then isolated from the cells and subjected to RT-PCR analysis.

Article Snippet: DNMT3A shRNAs were purchased from OriGene Technologies (Rockville, MD).

Techniques: shRNA, Knockdown, Expressing, Transfection, Construct, Plasmid Preparation, Western Blot, Reverse Transcription Polymerase Chain Reaction, Isolation

Journal: Molecular Cancer

Article Title: Benzo[ a ]pyrene diol epoxide suppresses retinoic acid receptor-β 2 expression by recruiting DNA (cytosine-5-)-methyltransferase 3A

doi: 10.1186/1476-4598-9-93

Figure Lengend Snippet: DNMT3A shRNA antagonized BPDE's effect on gene expression to different levels . Esophageal cancer SKGT-4 and TE3 cells were grown and transiently transfected with the empty vector or DNMT3A shRNA-3 vector for 48 h. The cells were then treated with or without 1 μM BPDE for 12 h, and the total cellular protein was extracted and subjected to Western blotting analysis of c-Jun, phosphorylated-ERK1/2 and COX-2 expression.

Article Snippet: DNMT3A shRNAs were purchased from OriGene Technologies (Rockville, MD).

Techniques: shRNA, Gene Expression, Transfection, Plasmid Preparation, Western Blot, Expressing

Journal: Medicine

Article Title: Plasma miR-200c-3p, miR-100-5p, and miR-1826 serve as potential diagnostic biomarkers for knee osteoarthritis

doi: 10.1097/md.0000000000018110

Figure Lengend Snippet: Figure 3. Detections of DNMT3A, ZEB1, MMP13, and CTNNB1 protein expression in articular cartilage tissue. Target gene/internal reference control gray value comparison. A: KOA (1.36), Control (0.64); B: KOA (1.29), Control (0.63); C: KOA (1.34), Control (0.50); D: KOA(1.06), Control (0.42).

Article Snippet: These samples were used for western blotting to detect the protein levels of DNMT3A (anti-human DNMT3A antibody, #681615, R&D systems, Minneapolis, MN, USA), ZEB1 (anti-human ZEB1 antibody, #639914, R&D Systems), MMP13 (anti-human MMP13 antibody, #87512, R&D Systems), and CTNNB1 (anti-human CTNNB1 antibody, #196621, R&D Systems).

Techniques: Expressing, Control, Comparison

Journal: Medicine

Article Title: Plasma miR-200c-3p, miR-100-5p, and miR-1826 serve as potential diagnostic biomarkers for knee osteoarthritis

doi: 10.1097/md.0000000000018110

Figure Lengend Snippet: Figure 4. Correlation of miRNAs expression levels with their target mRNA levels. A is the correlation between miR-200c-3p expression level and DNMT3A mRNA level in synovial fluid; B is the correlation between miR-200c-3p expression level and ZEB1 mRNA level in synovial fluid; C is the correlation between miR-100-5p expression level and MMP13 mRNA level in synovial fluid; D is the correlation between miR-1826 expression level and CTNNB1 mRNA level in synovial fluid.

Article Snippet: These samples were used for western blotting to detect the protein levels of DNMT3A (anti-human DNMT3A antibody, #681615, R&D systems, Minneapolis, MN, USA), ZEB1 (anti-human ZEB1 antibody, #639914, R&D Systems), MMP13 (anti-human MMP13 antibody, #87512, R&D Systems), and CTNNB1 (anti-human CTNNB1 antibody, #196621, R&D Systems).

Techniques: Expressing

Journal: Scientific Reports

Article Title: The up-regulation of SYNCRIP promotes the proliferation and tumorigenesis via DNMT3A/p16 in colorectal cancer

doi: 10.1038/s41598-024-59575-6

Figure Lengend Snippet: Effect of SYNCRIP on regulating the expression of DNMT3A. ( A – C ) SW480 and HCT116 cells were infected with scr or SYNCRIP shRNA (SYN sh) for 72 h, the mRNA and protein level of DNMTs were detected by QRT-PCR ( A , B ) and Western blotting ( C ). * P ˂ 0.05, ** P ˂ 0.01. ( D – F ) SW480 and HCT116 cells were transfected with empty vector (EV) and SYNCRIP plasmid, the mRNA and protein level of DNMTs were detected by QRT-PCR ( D , E ) and Western blotting ( F ). * P ˂ 0.05, ** P ˂ 0.01. ( G ) Expression level of DNMT3A in tumor is higher than in normal tissue, shown by GEPIA database. ( H ) The correlation between SYNCRIP and DNMT3A in colorectal cancer.

Article Snippet: DNMT3A overexpression plasmid was purchased from Origene (#RC208192, MD USA).

Techniques: Expressing, Infection, shRNA, Quantitative RT-PCR, Western Blot, Transfection, Plasmid Preparation

Journal: Scientific Reports

Article Title: The up-regulation of SYNCRIP promotes the proliferation and tumorigenesis via DNMT3A/p16 in colorectal cancer

doi: 10.1038/s41598-024-59575-6

Figure Lengend Snippet: SYNCRIP regulated colorectal cancer cell growth and migration via DNMT3A. ( A ) SW480 and HCT116 cells were infected with scr or SYNCRIP shRNA followed with or without DNMT3A plasmid, the protein level of DNMT3A was detected by Western blotting. ( B , C ) SW480 and HCT116 cells were infected with scr or SYNCRIP shRNA followed with or without DNMT3A plasmid, the proliferation and survival of SW480 and HCT116 cells were measured using CCK-8 assay ( B ) and trypan blue stain ( C ). ** P ˂ 0.01. ( D , E ) SW480 and HCT116 cells were infected with scr or SYNCRIP shRNA followed with or without DNMT3A plasmid, the motility of SW480 and HCT116 cells were analyzed using migration assay ( D ) and wound healing assay ( E ).

Article Snippet: DNMT3A overexpression plasmid was purchased from Origene (#RC208192, MD USA).

Techniques: Migration, Infection, shRNA, Plasmid Preparation, Western Blot, CCK-8 Assay, Staining, Wound Healing Assay

Journal: Scientific Reports

Article Title: The up-regulation of SYNCRIP promotes the proliferation and tumorigenesis via DNMT3A/p16 in colorectal cancer

doi: 10.1038/s41598-024-59575-6

Figure Lengend Snippet: SYNCRIP regulated the expression of p16 via DNMT3A. ( A , B ) SW480 and HCT116 cells were infected with scr or DNMT3A shRNA for 72 h, the protein and mRNA level of p16 were detected by Western blotting ( A ) and QRT-PCR ( B ). ** P ˂ 0.01. ( C , D ) SW480 and HCT116 cells were infected with scr or SYNCRIP (shRNA) shRNA followed with or without DNMT3A plasmid, the protein and mRNA level of p16 were detected by Western blotting (C) and QRT-PCR ( D ). ** P ˂ 0.01. ( E ) The correlation between SYNCRIP and p16 in colorectal cancer.

Article Snippet: DNMT3A overexpression plasmid was purchased from Origene (#RC208192, MD USA).

Techniques: Expressing, Infection, shRNA, Western Blot, Quantitative RT-PCR, Plasmid Preparation

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Tcl1 protein functions as an inhibitor of de novo DNA methylation in B-cell chronic lymphocytic leukemia (CLL)

doi: 10.1073/pnas.1200003109

Figure Lengend Snippet: Tcl1 interacts with Dnmt3A and Dnmt3B. (A) (Left) HEK 293 cells were cotransfected with DNMT3A-FLAG and 2xHA-TCL1 or with DNMT3A-FLAG and 2xHA-FHIT as indicated. After lysis, immunoprecipitation was carried out using anti-FLAG, IgG, or anti-HA antibodies. Western blot analysis was performed as indicated. (Right) HEK 293 cells were cotransfected DNMT3A-FLAG and Omni-GST-TCL1 or with DNMT3A-FLAG and Omni-GST-FHIT as indicated. After lysis and GST pulldown, Western blot analysis was performed as indicated. (B) Same as A, except using DNMT3B-FLAG instead DNMT3A-FLAG. (C) Daudi cells were lysed, and immunoprecipitation was carried out using anti-Tcl1, IgG, anti-Dnmt3A, or anti-Dnmt3B antibodies. Western blot analysis was performed as indicated. (D) HEK 293 cells were cotransfected with DNMT3A-FLAG and 2xHA-TCL1, 2xHA-FHIT, or 2xHA-TCL1b as indicated. After lysis, immunoprecipitation was carried out using anti-FLAG or anti-HA antibodies, and Western blot analysis was performed as indicated. (E) HEK 293 cells were cotransfected with Omni-GST-DNMT3B and 2xHA-TCL1, 2xHA-FHIT, or 2xHA-TCL1b as indicated. After lysis and GST pulldown, Western blot analysis was performed using anti-Omni (Top) or anti-HA (Middle and Bottom) antibodies. (F) Same as A, Left, but using DNMT1-FLAG instead of DNMT3A-FLAG. (G) Same as A, Left, but using DNMT3L-FLAG instead DNMT3A-FLAG.

Article Snippet: Expression constructs containing Myc/FLAG-tagged ORFs of human DNMT3A , DNMT3B , DNMT3L , and DNMT1 , designated DNMT3A -FLAG, DNMT3B -FLAG, DNMT3L -FLAG, and DNMT1 -FLAG, respectively, were purchased from OriGene.

Techniques: Lysis, Immunoprecipitation, Western Blot

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Tcl1 protein functions as an inhibitor of de novo DNA methylation in B-cell chronic lymphocytic leukemia (CLL)

doi: 10.1073/pnas.1200003109

Figure Lengend Snippet: Intracellular localization of Tcl1, Dnmt3a, and Dnmt3b. NIH 3T3 cells were cotransfected with pCMV5-TCL1, Omni-DNMT3A, and Omni-DNMT3B as indicated. Sixteen hours later, cells were fixed, permeabilized, and immunostained with mouse anti-Tcl1 and rabbit anti-Omni antibodies. Secondary antibodies goat anti-mouse Alexa Fluor 546 (red) and goat anti-rabbit Alexa Fluor 488 (green) were used to visualize intercellular locations of Tcl1 (red), Dnmt3A (green), and Dnmt3B (green). Colocalization of Tcl1 with Dnmt3A or Dnmt3B is shown in yellow.

Article Snippet: Expression constructs containing Myc/FLAG-tagged ORFs of human DNMT3A , DNMT3B , DNMT3L , and DNMT1 , designated DNMT3A -FLAG, DNMT3B -FLAG, DNMT3L -FLAG, and DNMT1 -FLAG, respectively, were purchased from OriGene.

Techniques:

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Tcl1 protein functions as an inhibitor of de novo DNA methylation in B-cell chronic lymphocytic leukemia (CLL)

doi: 10.1073/pnas.1200003109

Figure Lengend Snippet: Tcl1 inhibits Dnmt3a enzymatic activity. (Upper) HEK 293 cells were cotransfected with DNMT3A-FLAG and either 2xHA-TCL1 or vector construct. HEK 293 cells transfected only with vector were used as a negative control. Cell lysates were immunoprecipitated for 2 h with anti-FLAG. Dnmt3a enzymatic activity was measured as described in Materials and Methods. (Lower) Amounts of Dnmt3A and Tcl1 in Dnmt3a activity assay were measured by Western blot analysis using anti-HA and anti-FLAG antibodies as indicated. The experiment was carried out in duplicate. Lanes 1 and 2 correspond to the left bar, lanes 3 and 4 correspond to the middle bar, and lanes 5 and 6 correspond to the right bar.

Article Snippet: Expression constructs containing Myc/FLAG-tagged ORFs of human DNMT3A , DNMT3B , DNMT3L , and DNMT1 , designated DNMT3A -FLAG, DNMT3B -FLAG, DNMT3L -FLAG, and DNMT1 -FLAG, respectively, were purchased from OriGene.

Techniques: Activity Assay, Plasmid Preparation, Construct, Transfection, Negative Control, Immunoprecipitation, Western Blot

Journal: Proceedings of the National Academy of Sciences of the United States of America

Article Title: Tcl1 protein functions as an inhibitor of de novo DNA methylation in B-cell chronic lymphocytic leukemia (CLL)

doi: 10.1073/pnas.1200003109

Figure Lengend Snippet: Inhibition of Dnmt3a/3b is a common mechanism in leukemias and lymphomas.

Article Snippet: Expression constructs containing Myc/FLAG-tagged ORFs of human DNMT3A , DNMT3B , DNMT3L , and DNMT1 , designated DNMT3A -FLAG, DNMT3B -FLAG, DNMT3L -FLAG, and DNMT1 -FLAG, respectively, were purchased from OriGene.

Techniques: Inhibition